Phone: +1 (917) 719-0012
Email: info@genearrays.com
Sanger sequencing utilizes four-dye fluorescent labeling dideoxy-termination methods and a real-time scanning detector. Automated DNA sequencing is performed at the GCF using the Applied Biosystems Prism 3730xl Genetic Analyzer. This sequencer automatically performs the electrophoresis, calls the bases and archives the data.
With the DNA templates submitted by the user, we perform the following: run the cycle sequencing reactions, purify the sequencing products, run the products on the sequencer and then notify the submitter by email when the data is ready to be retrieved. The ABI electropherogram is retrieved via website. Depending on the purity of DNA preparation and size of the template, over 800 nucleotide bases will be provided in less than 3 days (turnaround time is dependent on overall demand for the service). Clinical sequencing samples have higher priority than research samples.
Templates
The sequencing templates can be circular single- or double-stranded DNA (ex. plasmids or cosmids) or linear PCR-generated products.
Dilute DNA Sample and/or primer in water at concentrations specified below.
Submit samples in be 0.2 ml strip tubes and caps with sample numbers on the side of tube.
Note: Template and primer concentration shown are before combining the two.
| Template | Template Concentration | Sequencing Primer Concentration | Sample Submission (in 0.2 ml tube) |
|---|---|---|---|
| PCR Products (<2 kb) |
5 ng/µl | 4 µM | Mix 16 µl of template with 4 µl primer |
| PCR DNA (>2kb) | 25 – 50 ng/µl | 4 µM | |
| Plasmids/Miniprep | 50 – 100 ng/µl | 4 µM | |
| Cosmid, BAC, PAC DNA (10-200kb) | 500 ng/µl | 40 µM | Mix 24 µl of template with 2.5µl of primer |
Sequencing primers can either be supplied by the user or the user can request that the GCF supply one of the following standard sequencing primers:
| Sequencing primer name | Sequence (5′ to 3′) |
|---|---|
| M13F | TGTAAAACGACGGCCAGT |
| M13R | CAGGAAACAGCTATGACC |
| SP-6 | ATTTAGGTGACACTATAG |
| T-3 | ATTAACCCTCACTAAAGGGA |
| T-7 | TAATACGACTCACTATAGGG |